Review



paper emdb emd 61398 em map  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier
Bioz Manufacturer Symbol Thermo Fisher manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94

    Structured Review

    Thermo Fisher paper emdb emd 61398 em map
    Paper Emdb Emd 61398 Em Map, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/paper+emdb+emd+61398+em+map/GENTAMYCIN+SULFATE+1GR+1GR/pm40378849-762-71-93
    Average 94 stars, based on 1 article reviews
    paper emdb emd 61398 em map - by Bioz Stars, 2026-09
    94/100 stars

    Images

    Related Articles

    Recombinant:

    Article Title: Structural insights into auxin influx mediated by the Arabidopsis AUX1.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-Flag mouse monoclonal antibody CoWin Biosciences Cat#CW0287; RRID: AB_3095798 HRP-conjugated goat-anti-mouse IgG CoWin Biosciences Cat#CW0102S; RRID: AB_2736997 Anti-Vinculin rabbit polyclonal antibody Proteintech Cat#26520-1-AP; RRID: AB_2868558 HRP-conjugated goat-anti-rabbit IgG Proteintech Cat#SA00001-2; RRID: AB 2722564 Bacterial and virus strains DH5α competent cell Invitrogen Cat#18265017 DH10Bac competent cell Invitrogen Cat#10361012 BL21 (DE3) competent cell NEB BioLabs Cat#C2527H Chemicals, peptides, and recombinant proteins Polyethylenimines linear (PEI) YEASEN Cat#40815ES n-dodecyl-β-D-maltopyranoside (DDM) Anatrace Cat#D310 Cholesteryl HemisuccinateTRIS Salt (CHS) Anatrace Cat#CH210 Aprotinin MCE Cat#HY-P0017 Murashige & Skoog Basal Medium including vitamins Duchefa Biochemie Cat#M0222.0050 Plant Agar Duchefa Biochemie Cat#P1001.1000 Pepstatin A MCE Cat#HY-P0018 Leupeptin MCE Cat#HY-18234A phenylmethylsulfonyl fluoride (PMSF) Sigma Aldrich Cat#P7626 Phosphate-buffered saline (PBS) biosharp Cat#BL316A Triton X-100 Sigma Aldrich Cat#T8787 IAA sodium salt Sigma Aldrich Cat#I5148 IAA Sigma Aldrich Cat#I3750 2,4-D Sigma Aldrich Cat#49083 1-NAA Sigma Aldrich Cat#35745 IBA Sigma Aldrich Cat#57310 1-NOA Macklin Cat#976-75-2 2-NOA Sigma Aldrich Cat#N3405 CHPAA Sigma Aldrich Cat#224529 NPA Sigma Aldrich Cat#33371 TIBA Sigma Aldrich Cat#120979 Bio-Beads SM-2 Bio-Rad Cat#1523920 [3H]-IAA American Radiolabeled Chemicals Cat#ART0340 Optiphase HiSafe 3 PerkinElmer Cat#152-21501 Critical commercial assays Trelief ® RNAprep FastPure Tissue & Cell Kit Tsingke Cat#TSP413 PrimeScriptTM RT Master Mix (Perfect Real Time) Takara Cat#RR036A Deposited data Crystal structure of sodium-coupled neutral amino acid transporter SLC38A9 Lei et al.56 PDB: 7KGV Cryo-EM structure of KimA from Bacillus subtilis in inward-facing, occluded state Tascón et al.50 PDB: 6S3K Crystal Structure of AdiC from E. coli Ilgü et al.52 PDB: 5J4I (Continued on next page) ll OPEN ACCESS Cell 188, 1–14.e1–e7, July 24, 2025 e1 Please cite this article in press as: Yang et al., Structural insights into auxin influx mediated by the Arabidopsis AUX1, Cell (2025), https://doi. org/10.1016/j.cell.2025.04.028 Article .. REAGENT or RESOURCE SOURCE IDENTIFIER Crystal Structure of ApcT Transporter Bound to Fab Fragment Shaffer et al.53 PDB: 3GI9 Coordinate of the apo-state of AUX1 This paper PDB: 9JDR Coordinate of the IAA-bound state of AUX1 This paper PDB: 9JDS Coordinate of the CHPAA-bound state of AUX1 This paper PDB: 9M2H EM map of the apo-state of AUX1 This paper EMDB: EMD-61397 EM map of the IAA-bound state of AUX1 This paper EMDB: EMD-61398 EM map of the CHPAA-bound state of AUX1 This paper EMDB: EMD-63585 Experimental models: Cell lines Human: HEK293F cell Gibco Cat#A14635 Spodoptera frugiperda: Sf9 cell Gibco Cat#11496015 Experimental models: Organisms/strains Arabidopsis thaliana: wild-type (Col-0) N/A N/A A. thaliana: aux1-100 Bennett et al.10; Swarup et al.60 N9586 A. thaliana: pAUX1::AUX1; aux1-100 This paper N/A A. thaliana: pAUX1::AUX1N58A; aux1-100 This paper N/A A. thaliana: pAUX1::AUX1Q62A; aux1-100 This paper N/A A. thaliana: pAUX1::AUX1V63A; aux1-100 This paper N/A A. thaliana: pAUX1::AUX1F145A; aux1-100 This paper N/A A. thaliana: pAUX1::AUX1Q153A; aux1-100 This paper N/A A. thaliana: pAUX1::AUX1Y244A; aux1-100 This paper N/A A. thaliana: pAUX1::AUX1H249A; aux1-100 This paper N/A Oligonucleotides Primer for AUX1-pCAG-OSF-F: GATGACGATGACAA GGGTACCTCGGAAGGAGTAGAAGCGATAG Sangon Biotech N/A Primer for AUX1-pCAG-OSF-R: CTGAGGAGTGAATTCC TCGAGTTAAAGACGGTGGTGTAAAG Sangon Biotech N/A Primer for AUX1-pFastBac-NF-F: GATGACGATGACAAG CATATGTCGGAAGGAGTAGAAGCGATAG Sangon Biotech N/A Primer for AUX1-pFastBac-NF-R: GTGATGGTGATGC TCGAGTTAAAGACGGTGGTGTAAAG Sangon Biotech N/A Primer for RT-PCR-F: TTCTCTCTTATGCCCAAGAACG Sangon Biotech N/A Primer for RT-PCR-R: CACTTTCTCCCACACAAAGTAC Sangon Biotech N/A Recombinant DNA pFastbac1-N-FLAG-AUX1-BRIL This paper N/A pCAG-Fab-Light chain-C-8*His This paper N/A pCAG-Fab-Heavy chain-C-8*His This paper N/A pCAG-N-OSF-AUX1 This paper N/A pET-21b-N-6*His-anti Fab nanobody This paper N/A pET-21b-N-6*His-NW11 MSP This paper N/A pDONRP4P1R-pAUX1 This paper N/A pENTR D-TOPO-pAUX1::AUX1 This paper N/A pENTR D-TOPO-pAUX1::AUX1N58A This paper N/A pENTR D-TOPO-pAUX1::AUX1Q62A This paper N/A pENTR D-TOPO-pAUX1::AUX1V63A This paper N/A pENTR D-TOPO-pAUX1::AUX1F145A This paper N/A pENTR D-TOPO-pAUX1::AUX1Q153A This paper N/A pENTR D-TOPO-pAUX1::AUX1Y244A This paper N/A (Continued on next page) ll OPEN ACCESS e2 Cell 188, 1–14.e1–e7, July 24, 2025 Please cite this article in press as: Yang et al., Structural insights into auxin influx mediated by the Arabidopsis AUX1, Cell (2025), https://doi. org/10.1016/j.cell.2025.04.028 Article .. REAGENT or RESOURCE SOURCE IDENTIFIER pENTR D-TOPO-pAUX1::AUX1H249A This paper N/A pB7m24GW3-pAUX1::AUX1 This paper N/A pB7m24GW3-pAUX1::AUX1N58A This paper N/A pB7m24GW3-pAUX1::AUX1Q62A This paper N/A pB7m24GW3-pAUX1::AUX1V63A This paper N/A pB7m24GW3-pAUX1::AUX1F145A This paper N/A pB7m24GW3-pAUX1::AUX1Q153A This paper N/A pB7m24GW3-pAUX1::AUX1Y244A This paper N/A pB7m24GW3-pAUX1::AUX1H249A This paper N/A Software and algorithms EPU (v.2.12) Thermo Fisher Scientific https://www.thermofisher.cn/cn/zh/home/ electron-microscopy/products/softwareem-3d-vis/epu-software.html UCSF ChimeraX (v.1.2.5) Meng et al.69 https://www.cgl.ucsf.edu/chimerax PyMol software (v.2.5.2) The PyMOL Molecular Graphics System, Schrödinger, LLC https://pymol.org/2 CAVER (3.0) Chovancova et al.70 https://caver.cz Ligplot+ Laskowski and Swindells57 https://www.ebi.ac.uk/thornton-srv/ software/LigPlus Coot (v.0.9.6) Emsley et al.71 https://www2.mrc-lmb.cam.ac.uk/ personal/pemsley/coot Phenix (v.1.20.1-4487) Adams et al.72 https://www.phenix-online.org cryoSPARC (v.4.3.0) Punjani et al.73 https://cryosparc.com GraphPad Prism 8 GraphPad Software https://www.graphpad.com Relion3.0 Zivanov et al.74 https://www2.mrc-lmb.cam.ac.uk/relion MotionCor2 Zheng et al.75 https://emcore.ucsf.edu/ucsf-software CTFFIND4 Rohou and Grigorieff76 https://grigoriefflab.umassmed.edu/ctffind4 MicroCal PEAQ-ITC Analysis Software (v.1.22) Malvern Panalytical https://www.malvernpanalytical.com.cn/ support/product-support/software/ microcal-peaq-itc-analysis-software-v141 MO.Control (v.1.6.1) Nanotemper https://support.nanotempertech.com/hc/en-us/ sections/17715198724753-Software MO.Affinity Analysis (v.2.3) Nanotemper https://support.nanotempertech.com/hc/en-us/ sections/17715198724753-Software PROPKA (v.3.4.0) Olsson et al.77 https://www.ddl.unimi.it/vegaol/propka.htm GROMACS (v.2021.4) Abraham et al.78 https://www.gromacs.org CGenFF Vanommeslaeghe et al.79 https://cgenff.com gmx_MMPBSA Valdés-Tresanco et al.63 and Miller et al.64 https://valdes-https://tresanco-ms.github.io/ gmx_MMPBSA/dev Other SuperoseTM 6 Increase 10/300 GL GE Healthcare GE-29-0915-96 10 kDa molecular weight cut-off Milipore Amincon Ultra-4 Anti-FLAG M2 affinity gel Sigma Aldrich Cat#A2220 Ni-NTA resin Qiagen Cat#30410 SuperSignalTM West Pico PLUS chemiluminescent substrate Thermo Fisher Scientific Cat#34577 SMM 293-TII medium Sino Biological Cat#M293TII SIM SF medium Sino Biological Cat#MSF1 Quantifoil R1.2/1.3 300-mesh gold grids Quantifoil Cat#Q59042 ll OPEN ACCESS Cell 188, 1–14.e1–e7, July 24, 2025 e3 Please cite this article in press as: Yang et al., Structural insights into auxin influx mediated by the Arabidopsis AUX1, Cell (2025), https://doi. org/10.1016/j.cell.2025.04.028 Article



    Similar Products

    94
    Thermo Fisher paper emdb emd 61398 em map
    Paper Emdb Emd 61398 Em Map, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/paper+emdb+emd+61398+em+map/GENTAMYCIN+SULFATE+1GR+1GR/pm40378849-762-71-93
    Average 94 stars, based on 1 article reviews
    paper emdb emd 61398 em map - by Bioz Stars, 2026-09
    94/100 stars
      Buy from Supplier

    Image Search Results